Stem-loop sequence csi-MIR166c

AccessionMI0016694 (change log)
DescriptionCitrus sinensis miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention csi-MIR166c
(12 sentences)

Stem-loop
   uuccuccucgaucauaca     --     a        uu                c   -u      auuaauu 
5'                   ugaac  gguug ggggaaug  gucugguucgagauca ucg  ggacga       a
                     |||||  ||||| ||||||||  |||||||||||||||| |||  ||||||        
3'                   auuug  ucaac ccccuuac  cggaccaggcuuuagu agu  ucuguu       a
   -------------cguua     ac     c        uu                a   uu      auucaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr5: 32146390-32146527 [+]
intergenic
Database links

Mature sequence csi-miR166c-5p

Accession MIMAT0037393
Sequence

31 - 

gggaauguugucugguucgag

 - 51

Get sequence
Evidence experimental; Illumina [2]

Mature sequence csi-miR166c-3p

Accession MIMAT0018451
Sequence

100 - 

ucggaccaggcuucauuccc

 - 119

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).