Stem-loop sequence csi-MIR156a

AccessionMI0016691 (change log)
DescriptionCitrus sinensis miR156a stem-loop
Gene family MIPF0000008; MIR156
Literature search

7 open access papers mention csi-MIR156a
(36 sentences)

Stem-loop
         a cua            -         a   ag    uu     a 
5' cgagag g   cugacagaagag agugagcac cgc  guaa  guauu g
   |||||| |   |||||||||||| ||||||||| |||  ||||  |||||  
3' guuuuu c   gacugucuucuc ucgcucgug gug  cguu  uauaa a
         a ugc            c         c   ga    uc     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr4: 392462-392564 [+]
intergenic
Database links

Mature sequence csi-miR156a-5p

Accession MIMAT0018448
Sequence

13 - 

ugacagaagagagugagcac

 - 32

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence csi-miR156a-3p

Accession MIMAT0037391
Sequence

72 - 

ugcucgcuccucuucugucagc

 - 93

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).