Stem-loop sequence ngi-mir-133

AccessionMI0016653 (change log)
DescriptionNasonia giraulti miR-133 stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
            g  -            cac  gu     auaa  -  c 
5' uaauguuaa cu uagcugguugaa   gg  caaau    cg ca g
   ||||||||| || ||||||||||||   ||  |||||    || ||  
3' auuacaguu ga gucgaccaacuu   cc  guuua    gc gu a
            -  u            -cc  ug     ---c  a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-133

Accession MIMAT0018412
Sequence

57 - 

uugguccccuucaaccagcugu

 - 78

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).