Stem-loop sequence ngi-mir-252

AccessionMI0016651 (change log)
DescriptionNasonia giraulti miR-252 stem-loop
Gene family MIPF0000285; mir-252
Stem-loop
   aaucccguc     cc        a u  c       -  --------a    ac 
5'          cuguu  uaaguacu g gc gcaggag ug         cuag  u
            |||||  |||||||| | || ||||||| ||         ||||   
3'          gguaa  auucguga c cg cguccuc gc         gauc  g
   ---------     cu        a u  u       u  gccauuaaa    gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-252

Accession MIMAT0018410
Sequence

18 - 

aaguacuagugccgcaggag

 - 37

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).