Stem-loop sequence ngi-mir-137

AccessionMI0016638 (change log)
DescriptionNasonia giraulti miR-137 stem-loop
Gene family MIPF0000106; mir-137
Stem-loop
   ---      ug  g   c       ug  g   u    - a a 
5'    ccaggu  gc acg guauucu  gg aau aaca c c u
      ||||||  || ||| |||||||  || ||| |||| | |  
3'    gguccg  ug ugc cauaaga  uc uua uugu g g a
   gcu      uu  a   a       gu  g   -    c c c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-137

Accession MIMAT0018397
Sequence

49 - 

uuauugcuugagaauacacgua

 - 70

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).