Stem-loop sequence ngi-mir-13a

AccessionMI0016637 (change log)
DescriptionNasonia giraulti miR-13a stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   cu       u    -ua       u         a   ucuc 
5'   uuugcgg ccga   caucaaa ugguugugg aug    g
     ||||||| ||||   ||||||| ||||||||| |||    u
3'   agaugcc gguu   guaguuu accgacacu uac    c
   -a       c    cga       u         a   cuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-13a

Accession MIMAT0018396
Sequence

51 - 

uaucacagccauuuugaugag

 - 71

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).