Stem-loop sequence ngi-mir-263b

AccessionMI0016636 (change log)
DescriptionNasonia giraulti miR-263b stem-loop
Gene family MIPF0000122; mir-263
Stem-loop
   agguu ug      cu     c  g    a     a   g    gu 
5'      c  gcgggu  uggca ug aaga uucac gau ugcg  u
        |  ||||||  ||||| || |||| ||||| ||| ||||   
3'      g  cgccca  accgu ac uucu aggug cua augu  g
   ----- gu      uu     a  g    -     -   -    gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-263b

Accession MIMAT0018395
Sequence

15 - 

cuuggcacuggaagaauucac

 - 35

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).