Stem-loop sequence ngi-mir-14

AccessionMI0016630 (change log)
DescriptionNasonia giraulti miR-14 stem-loop
Gene family MIPF0000182; mir-14
Stem-loop
   ucgcucg           u      cu    u    a g   ucc 
5'        gucaguggggg gagaaa  ggcu ggcu u uac   c
          ||||||||||| ||||||  |||| |||| | |||    
3'        cgguuauccuc cucuuu  cuga cuga a gug   c
   -------           u      uu    -    c g   uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-14

Accession MIMAT0018389
Sequence

59 - 

ucagucuuuuucucucuccua

 - 79

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).