Stem-loop sequence ngi-mir-275

AccessionMI0016627 (change log)
DescriptionNasonia giraulti miR-275 stem-loop
Gene family MIPF0000187; mir-275
Stem-loop
   -   a u         - c       ac      gc 
5'  gca c cgcgcuacu c gguacuu  gacugu  a
    ||| | ||||||||| | |||||||  ||||||  u
3'  cgu g gcgcgauga g ccaugga  cugaua  u
   g   c c         a u       --      gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-275

Accession MIMAT0018386
Sequence

44 - 

ucagguaccugaaguagcgcgcg

 - 66

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).