Stem-loop sequence ngi-mir-1

AccessionMI0016626 (change log)
DescriptionNasonia giraulti miR-1 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   ---cu            c    uuc     -  gc 
5'      guuccgugcuuc uuac   ccaua gu  a
        |||||||||||| ||||   ||||| ||  c
3'      cgagguaugaag aaug   gguau ca  g
   cgcgc            a    uaa     g  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-1

Accession MIMAT0018385
Sequence

42 - 

uggaauguaaagaaguauggag

 - 63

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).