Stem-loop sequence ssc-mir-149

AccessionMI0016620 (change log)
DescriptionSus scrofa miR-149 stem-loop
Gene family MIPF0000274; mir-149
Literature search

3 open access papers mention ssc-mir-149
(4 sentences)

Stem-loop
       a   u u g      g     a     -gug  u 
5' gccc ggc c g cuccgu ucuuc cuccc    ug g
   |||| ||| | | |||||| ||||| |||||    ||  
3' cggg ucg g c ggggca ggagg gaggg    gc u
       g   u u g      g     -     agga  c 
Get sequence
Deep sequencing
651 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr15: 154447027-154447102 [-]
sense
ENSSSCT00000017819 ; GPC1-201; intron 1
Database links

Mature sequence ssc-miR-149

Accession MIMAT0018379
Sequence

9 - 

ucuggcuccgugucuucacuccc

 - 31

Get sequence
Deep sequencing644 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2-3]

References

1
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).