Stem-loop sequence hsa-mir-3935

AccessionMI0016591 (change log)
Symbol HGNC:MIR3935
DescriptionHomo sapiens miR-3935 stem-loop
Literature search

2 open access papers mention hsa-mir-3935
(18 sentences)

Stem-loop 
   ggau      -     cca --a   --a    a  g         ug     a 
5'     guguuc cuguc   g   agg   gcug ug uuguaucua  aaggu a
       |||||| |||||   |   |||   |||| || |||||||||  |||||  
3'     cguaag gacgg   c   ucc   cgac ac agcauagau  uuuua g
   -auu      a     aaa gaa   cac    c  g         gu     c
Get sequence
Deep sequencing
52 reads, 3.03 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 56245520-56245623 [+]
sense
OTTHUMT00000434562 ; GNAO1-005; intron 1
OTTHUMT00000434590 ; GNAO1-011; intron 1
OTTHUMT00000256981 ; GNAO1-001; intron 2
OTTHUMT00000256982 ; GNAO1-002; intron 2
OTTHUMT00000434577 ; GNAO1-009; intron 2
OTTHUMT00000434561 ; GNAO1-004; intron 2
ENST00000565363 ; GNAO1-005; intron 1
ENST00000562316 ; GNAO1-011; intron 1
ENST00000262493 ; GNAO1-001; intron 2
ENST00000262494 ; GNAO1-002; intron 2
ENST00000569295 ; GNAO1-009; intron 2
ENST00000563661 ; GNAO1-004; intron 2
Database links

Mature sequence hsa-miR-3935

Accession MIMAT0018350
Sequence

58 -  

uguagauacgagcaccagccac

 - 79

Get sequence
Deep sequencing39 reads, 25 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20498841 "Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers" Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH PLoS One. 5:e10563(2010).