![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR4416a |
|||||
Accession | MI0016585 (change log) | ||||
Previous IDs | gma-MIR4416 | ||||
Description | Glycine max miR4416 stem-loop | ||||
Gene family | MIPF0001389; MIR4416 | ||||
Literature search |
![]()
5 open access papers mention gma-MIR4416a | ||||
Stem-loop |
---- au aa g ggauuggguucaguucuggucucacacggu 5' cuuug cugggugagag ac cguaucgau u ||||| ||||||||||| || ||||||||| 3' gagac gauccacucuc ug gcauagcua u cguu cg gc g guuuugugucagucauguuuaacaaucuug |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR4416a |
|
Accession | MIMAT0018344 |
Previous IDs | gma-miR4416 |
Sequence |
101 - acgggucgcucucaccuagg - 120 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"
BMC Bioinformatics. 11 Suppl 1:S14(2010).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|