Stem-loop sequence gma-MIR4415a

AccessionMI0016584 (change log)
Previous IDsgma-MIR4415
DescriptionGlycine max miR4415a stem-loop
Gene family MIPF0001314; MIR4415
Stem-loop
   ug    c g  a                      agcagugacaccaagaaaaaaaaaucccauuauaaacauuuuuuccccucaauc 
5'   gcug a ca guugugaugagaaucaauggca                                                      u
     |||| | || ||||||||||||||||||||||                                                       
3'   ugac u gu caacacuacucuuaguuaccgu                                                      u
   --    c g  a                      caacaccuaaauauaggaaguuguggucaaucggauuacuauaugauacucuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 56193529-56193704 [+]
intergenic
Database links

Mature sequence gma-miR4415a-5p

Accession MIMAT0018343
Previous IDsgma-miR4415
Sequence

11 - 

aaguugugaugagaaucaaug

 - 31

Get sequence
Evidence experimental; Illumina [1-3]

Mature sequence gma-miR4415a-3p

Accession MIMAT0020955
Sequence

150 - 

uugauucucaucacaacaugg

 - 170

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).