Stem-loop sequence gma-MIR394a

AccessionMI0016582 (change log)
DescriptionGlycine max miR394a stem-loop
Gene family MIPF0000100; MIR394
Literature search

12 open access papers mention gma-MIR394a
(23 sentences)

Stem-loop 
                a         u              -      u c            -c   cuacucucucucu 
5' aucaugaggguuu gcaaagugu gcuaacagaguuua uuggca u uguccaccucca  uuc             c
   ||||||||||||| ||||||||| |||||||||||||| |||||| | ||||||||||||  |||             u
3' uaguacuuccgaa uguuucaca cgguugucucgagu aacugu a acggguggaggu  aag             c
                a         u              c      c u            au   uacccaucucucu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 41517111-41517267 [+]
intergenic
Database links

Mature sequence gma-miR394a-5p

Accession MIMAT0022974
Sequence

39 -  

uuggcauucuguccaccucc

 - 58

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gma-miR394a-3p

Accession MIMAT0018341
Previous IDsgma-miR394a
Sequence

122 -  

agcucuguuggcuacacuuu

 - 141

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).