![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR4401a |
|||||
Accession | MI0016560 (change log) | ||||
Previous IDs | gma-MIR4401 | ||||
Description | Glycine max miR4401 stem-loop | ||||
Gene family | MIPF0001147; MIR4368 | ||||
Literature search |
1 open access papers mention gma-MIR4401a | ||||
Stem-loop |
u a u a u 5' cgucuu gaaugccuacuuucaaagac uuguugagguaagcaccgucuu gaa g a |||||| |||||||||||||||||||| |||||||||||||||||||||| ||| | 3' gcagaa cuuacggaugaaaguuucug aacaacuccauucgugguagaa cuu c c u c u a g |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR4401a |
|
Accession | MIMAT0018319 |
Previous IDs | gma-miR4401 |
Sequence |
85 - acaacgucuuugaaaguaggcauu - 108 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"
BMC Bioinformatics. 11 Suppl 1:S14(2010).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|