Stem-loop sequence gma-MIR4393b

AccessionMI0016558 (change log)
DescriptionGlycine max miR4393b stem-loop
Stem-loop
   u  a          a              g    ca                  a 
5'  ug cuucucugcu ucccuuuucaaguu uccc  ugcuuucccuucaaaacg c
    || |||||||||| |||||||||||||| ||||  ||||||||||||||||||  
3'  ac gaagagacga agggaaaaguucga aggg  acgaaagggaaguuuugc a
   a  c          c              a    ac                  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 49068990-49069101 [-]
intergenic
Database links

Mature sequence gma-miR4393b

Accession MIMAT0018317
Sequence

87 - 

uugaaaagggacagcagagaagcc

 - 110

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).