Stem-loop sequence gma-MIR4393a

AccessionMI0016549 (change log)
DescriptionGlycine max miR4393a stem-loop
Stem-loop
   c  a   c          c    c           -  aaaaucacacaguuuuaaaauugaaucac 
5'  ug cuu ucugcugucc uuuc cagcugucccu ug                             a
    || ||| |||||||||| |||| ||||||||||| ||                             a
3'  ac gaa agacggcagg aaag guugacaggga ac                             a
   a  c   a          a    a           c  agcagguacaucaacacaauuauaaauua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 1366374-1366509 [-]
intergenic
Database links

Mature sequence gma-miR4393a

Accession MIMAT0018308
Sequence

111 - 

ugagaaaaggacggcagaaaagcc

 - 134

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).