Stem-loop sequence gma-MIR4343b

AccessionMI0016547 (change log)
DescriptionGlycine max miR4343b stem-loop
Gene family MIPF0001150; MIR4343
Stem-loop
   u           ag                    
5'  uuucuucuuac  aucaaguugauucggaaga 
    |||||||||||  |||||||||||||||||| g
3'  aaaggagaaug  uaguucagcuaggccuuca 
   a           cu                    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 35003600-35003666 [-]
intergenic
Database links

Mature sequence gma-miR4343b

Accession MIMAT0018306
Sequence

7 - 

ucuuacagaucaaguugauucgga

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).