Stem-loop sequence gma-MIR4391

AccessionMI0016545 (change log)
DescriptionGlycine max miR4391 stem-loop
Stem-loop
           c         ---                           -uu   uagaca 
5' ggaccaag uguucuucu   uaguucuuugccgagagcuuaugaaaa   uug      u
   |||||||| |||||||||   |||||||||||||||||||||||||||   |||      c
3' cuugguuu acaagaaga   aucaagaaacggcucucgaauacuuuu   aac      a
           a         aga                           uau   uacaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 22864160-22864278 [+]
intergenic
Database links

Mature sequence gma-miR4391

Accession MIMAT0018304
Sequence

83 - 

ucucggcaaagaacuaagaagaag

 - 106

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).