Stem-loop sequence gma-MIR4378b

AccessionMI0016525 (change log)
DescriptionGlycine max miR4378b stem-loop
Gene family MIPF0001192; MIR4378
Stem-loop
   u                    cua     c   a    gg  uu 
5'  uagaacugucuuagaaugug   cauuc aag ugau  uc  c
    ||||||||||||||||||||   ||||| ||| ||||  ||  u
3'  aucuuggcagaaucuuacac   guaag uuc acua  ag  u
   a                    agc     a   c    aa  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 31722886-31722976 [-]
intergenic
Database links

Mature sequence gma-miR4378b

Accession MIMAT0018284
Sequence

2 - 

uagaacugucuuagaaugugcuac

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).