Stem-loop sequence gma-MIR4374a

AccessionMI0016519 (change log)
DescriptionGlycine max miR4374a stem-loop
Gene family MIPF0001152; MIR4374
Stem-loop
   -         u              a           gu        u     a   c        acaac     a   agc 
5'  ucaaagacg uguugacaucacga cgucuuagaaa  caggcuuc aagac gug ugacgucg     gucuu gaa   c
    ||||||||| |||||||||||||| |||||||||||  |||||||| ||||| ||| ||||||||     ||||| |||    
3'  aguuucugc acgacuguagugcu gcagaaucuuu  guccgaag uucug cac acugcagu     cagaa cuu   a
   a         c              g           ug        u     c   a        gccga     a   cca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 42014046-42014212 [-]
intergenic
Database links

Mature sequence gma-miR4374a

Accession MIMAT0018278
Sequence

135 - 

uaagacggucgugaugucagca

 - 156

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).