Stem-loop sequence gma-MIR4368a

AccessionMI0016508 (change log)
DescriptionGlycine max miR4368a stem-loop
Gene family MIPF0001147; MIR4368
Stem-loop
          a        a     c        a    u   a u 
5' ggcauuc aagacggu cuuac ucaguaac ucuu gaa g a
   ||||||| |||||||| ||||| |||||||| |||| ||| |  
3' ccguaag uuuugcca gaaug agucguug agaa cuu c a
          a        c     u        c    u   a a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 55058212-55058299 [-]
intergenic
Database links

Mature sequence gma-miR4368a

Accession MIMAT0018267
Sequence

9 - 

aagacgguacuuaccucaguaaca

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).