Stem-loop sequence gma-MIR4367

AccessionMI0016507 (change log)
DescriptionGlycine max miR4367 stem-loop
Stem-loop
                a     a  cc                 a                       a             c              ------cu     cacu   gg 
5' caauuuccaucaa acaau cu  ccuaaaaccuagaacaa auaugauauaauugauuuacuuc cuaggguucagga aauauucaaucaug        uggcu    gca  a
   ||||||||||||| ||||| ||  ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| ||||||||||||||        |||||    |||   
3' guuaaagguaguu uguua ga  ggauuuuggaucuuguu uauacuauguuaacuaaaugaag gaucccaaguccu uuauaaguuaguac        acuga    cgu  c
                c     c  aa                 c                       c             a              acucucuu     ---u   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 2417160-2417384 [+]
intergenic
Database links

Mature sequence gma-miR4367

Accession MIMAT0018266
Sequence

149 - 

cugaacccuagcgaaguaaauc

 - 170

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).