Stem-loop sequence gma-MIR4363

AccessionMI0016500 (change log)
DescriptionGlycine max miR4363 stem-loop
Stem-loop
        gg      --                cauccag              -ca  aa 
5' gccua  auaggc  ucugguaaucgauuac       uguaaucgauuaca   ug  c
   |||||  ||||||  ||||||||||||||||       ||||||||||||||   ||   
3' cggau  uauucg  agaccauuagcuaaug       acauuagcuaaugu   ac  a
        --      ga                uccuaca              ccg  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 19200043-19200157 [+]
intergenic
Database links

Mature sequence gma-miR4363

Accession MIMAT0018259
Sequence

92 - 

cgauuaccagaaggcuuauuag

 - 113

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).