Stem-loop sequence gma-MIR4353

AccessionMI0016483 (change log)
DescriptionGlycine max miR4353 stem-loop
Stem-loop
   c      u   c       uu         
5'  aagucg agc gguguua  acuucuga 
    |||||| ||| |||||||  ||||||| g
3'  uucagc uug ccacaau  ugaagacu 
   a      u   u       cc         
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 51362622-51362680 [-]
intergenic
chr8: 47811839-47811897 [-]
intergenic
chr13: 22156592-22156650 [-]
intergenic
Database links

Mature sequence gma-miR4353

Accession MIMAT0018242
Sequence

1 - 

caagucguagccgguguuauuacu

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).