Stem-loop sequence gma-MIR4344

AccessionMI0016473 (change log)
DescriptionGlycine max miR4344 stem-loop
Gene family MIPF0001152; MIR4374
Stem-loop
   uu     a        c   a                 ga    c       u    ga 
5'   aagac gugcuuac uca caacgucuuugaaagua  cauu uaagacg ugcu  u
     ||||| |||||||| ||| |||||||||||||||||  |||| ||||||| ||||   
3'   uuuug cacgaaug agu guugcagaaacuuucau  guaa auucugc acga  a
   -u     c        u   c                 gc    a       c    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 19606858-19606976 [-]
intergenic
Database links

Mature sequence gma-miR4344

Accession MIMAT0018232
Sequence

34 - 

aaguagacauucuaagacguugcu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).