Stem-loop sequence gma-MIR4340

AccessionMI0016469 (change log)
DescriptionGlycine max miR4340 stem-loop
Stem-loop
   --ac          -      g     ugaagu 
5'     aagcguguuc ugucuu gcagc      u
       |||||||||| |||||| |||||       
3'     uucgcgcagg auagag cgucg      c
   auca          g      a     uuaagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 2095404-2095468 [-]
intergenic
Database links

Mature sequence gma-miR4340

Accession MIMAT0018228
Sequence

41 - 

ugcagagauagggacgcgcuua

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).