Stem-loop sequence dpu-mir-305

AccessionMI0016448 (change log)
DescriptionDaphnia pulex miR-305 stem-loop
Stem-loop
   -------agua     g     u   u       uau    u      uuugaa 
5'            gagaa ugacc gcu uguacuu   cagg gcucug      a
              ||||| ||||| ||| |||||||   |||| ||||||       
3'            cucuu guugg cga acaugaa   gucc cgggac      u
   agccgcuccua     -     u   u       cgu    c      uccauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dpu-miR-305

Accession MIMAT0018924
Sequence

19 - 

uuuguacuuuaucaggugcucu

 - 40

Get sequence
Evidence not experimental

References

1
PMID:20702459 "A congruent solution to arthropod phylogeny: phylogenomics, microRNAs and morphology support monophyletic Mandibulata" Rota-Stabelli O, Campbell L, Brinkmann H, Edgecombe GD, Longhorn SJ, Peterson KJ, Pisani D, Philippe H, Telford MJ Proc Biol Sci. 278:298-306(2011).