Stem-loop sequence ame-mir-980

AccessionMI0016244 (change log)
DescriptionApis mellifera miR-980 stem-loop
Gene family MIPF0000890; mir-980
Stem-loop
   a     u    a  cg    g   uc     c     uauuu 
5'  gcuga uacg ug  gcuc uca  gggca uuugc     u
    ||||| |||| ||  |||| |||  ||||| |||||      
3'  ugacu augc ac  cggg agu  uccgu gaacg     u
   g     c    c  aa    a   uu     c     caaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000061.5: 6643088-6643173 [-]
intergenic
Database links

Mature sequence ame-miR-980-3p

Accession MIMAT0018614
Sequence

52 - 

aagcugccuuuugaagggcaaca

 - 74

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).