Stem-loop sequence ame-mir-3744

AccessionMI0016243 (change log)
DescriptionApis mellifera miR-3744 stem-loop
Stem-loop
   -   ---uau       ------        c     gaaa      -  g        ---auuuu   uuua 
5'  gag      uaaaguu      gacgguau uuugu    aauuuc ga aagaggga        gaa    a
    |||      |||||||      |||||||| |||||    |||||| || ||||||||        |||     
3'  cuc      guuucaa      cugucaua aaaua    uuaaag uu uucuccuu        cuu    a
   c   uaccuu       cuacuu        -     agaa      a  g        guaucuau   ugcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000061.5: 5438403-5438537 [+]
intergenic
Database links

Mature sequence ame-miR-3744-5p

Accession MIMAT0018613
Sequence

16 - 

cgguaucuuugugaaaaauuucg

 - 38

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).