Stem-loop sequence ame-mir-3743

AccessionMI0016242 (change log)
DescriptionApis mellifera miR-3743 stem-loop
Stem-loop
   ua     u     a   g           uc  c  -c     
5'   cuugg ccgag ggc gagaaggaagu  cg gg  gcgu 
     ||||| ||||| ||| |||||||||||  || ||  ||| u
3'   ggacc gguuc ccg cuuuucuuuca  gc cc  cgcc 
   -c     -     c   a           gu  u  cu     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000061.5: 4715932-4716013 [+]
intergenic
Database links

Mature sequence ame-miR-3743-3p

Accession MIMAT0018612
Sequence

51 - 

ucgugacuuucuuuucagccccu

 - 73

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).