Stem-loop sequence ame-mir-3738

AccessionMI0016237 (change log)
DescriptionApis mellifera miR-3738 stem-loop
Stem-loop
   -   aa    -    ---a    -au  u      -----a    gc 
5'  cgg  ucgc guuu    ccgg   gu uucgca      uuuc  g
    |||  |||| ||||    ||||   || ||||||      ||||   
3'  guu  agcg cgag    ggcc   cg aagugu      aaag  g
   a   ga    u    cagg    guu  u      guaaaa    gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000056.5: 13462598-13462682 [-]
intergenic
Database links

Mature sequence ame-miR-3738-5p

Accession MIMAT0018607
Sequence

10 - 

guuuaccggauguuuucgcaau

 - 31

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).