Stem-loop sequence ame-mir-3735

AccessionMI0016234 (change log)
DescriptionApis mellifera miR-3735 stem-loop
Stem-loop
   uaaa       --caa       --------------------    gc       augc 
5'     uaacgag     aguuucc                    ucgu  cgauaag    a
       |||||||     |||||||                    ||||  |||||||     
3'     auugcuu     ucaaagg                    agca  gcuauuc    a
   ---a       ccaag       ucaaaaagauaaccaaaaca    --       guuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000056.5: 10522746-10522840 [+]
intergenic
Database links

Mature sequence ame-miR-3735-5p

Accession MIMAT0018604
Sequence

7 - 

acgagcaaaguuuccucgugcc

 - 28

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).