Stem-loop sequence ame-mir-3734

AccessionMI0016233 (change log)
DescriptionApis mellifera miR-3734 stem-loop
Stem-loop
   aa   uuaau  a      cg    -   uuu  - ug     
5'   agg     gc guuagc  gucc ccc   ug g  gccc 
     |||     || ||||||  |||| |||   || |  ||| u
3'   ucc     cg cgauug  cagg ggg   ac c  uggu 
   -c   ----u  -      --    a   --c  g uu     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000056.5: 5417611-5417683 [+]
intergenic
Database links

Mature sequence ame-miR-3734-3p

Accession MIMAT0018603
Sequence

45 - 

uuucgcacgggaggacguuag

 - 65

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).