Stem-loop sequence ame-mir-3732

AccessionMI0016230 (change log)
DescriptionApis mellifera miR-3732 stem-loop
Stem-loop
   a    ---ucg   c    -u    u     --ugu    -   a   -     uaucaa    ucu    uuc 
5'  aucg      gag auca  ugug guguu     augc uuu cua cuuuc      auug   gggu   u
    ||||      ||| ||||  |||| |||||     |||| ||| ||| |||||      ||||   ||||    
3'  uagu      cuc uggu  guac cgcag     ugcg aaa ggu gaaag      ugac   ccca   c
   a    uuucua   -    uu    -     cgguu    u   g   u     ------    uuu    uuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000058.5: 13513238-13513371 [-]
intergenic
Database links

Mature sequence ame-miR-3732-3p

Accession MIMAT0018600
Sequence

105 - 

cgacgccauguuuggucucaucu

 - 127

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).