Stem-loop sequence ame-mir-3729

AccessionMI0016226 (change log)
DescriptionApis mellifera miR-3729 stem-loop
Stem-loop
   ----u   c   u    auc      -  -     u  gaag     a 
5'      caa gug aguu   ggaaaa ac agagu cg    agauc a
        ||| ||| ||||   |||||| || ||||| ||    |||||  
3'      guu cac ucaa   ccuuuu ug uuuca gu    ucuag g
   aaaac   -   -    --c      g  c     -  auaa     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000058.5: 1439160-1439246 [-]
intergenic
Database links

Mature sequence ame-miR-3729-3p

Accession MIMAT0018596
Sequence

64 - 

uguuuucccaacucacuugca

 - 84

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).