Stem-loop sequence ame-mir-3727

AccessionMI0016224 (change log)
DescriptionApis mellifera miR-3727 stem-loop
Stem-loop
   uc  ---c  u   uc       ac     -  ag 
5'   gc    ag cgg  gcgcguu  cgagc ca  u
     ||    || |||  |||||||  ||||| ||   
3'   cg    uc gcc  cgcgcaa  gcuug gu  g
   -u  aaaa  -   cu       gc     a  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 12291185-12291250 [-]
intergenic
Database links

Mature sequence ame-miR-3727-3p

Accession MIMAT0018594
Sequence

40 - 

uucgcgaacgcgcucccgcuaa

 - 61

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).