Stem-loop sequence ame-mir-3726

AccessionMI0016223 (change log)
DescriptionApis mellifera miR-3726 stem-loop
Stem-loop
   u   gaaagauaa     c       c    cc    ccgcgaa          -au           cau 
5'  ggc         acagg cgagugg acgg  uugu       cgaguggugg   gccagcguuua   u
    |||         ||||| ||||||| ||||  ||||       ||||||||||   |||||||||||    
3'  ccg         ugucc guuuacu ugcc  aacg       gcucaccgcu   ugguugcaaau   c
   g   ---------     c       c    --    ---acaa          auc           uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 11022608-11022736 [-]
intergenic
Database links

Mature sequence ame-miR-3726-5p

Accession MIMAT0018593
Sequence

43 - 

aacgagugguggaugccagcgu

 - 64

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).