Stem-loop sequence ame-mir-3725

AccessionMI0016222 (change log)
DescriptionApis mellifera miR-3725 stem-loop
Stem-loop
   ----uau      -aaa   a    aucg      ----       a    g g    cuu 
5'        uuggau    guu uuau    gaagaa    ggaagag gaga a agau   u
          ||||||    ||| ||||    ||||||    ||||||| |||| | ||||   u
3'        aaccug    uag aaug    cuucuu    ucuuuuc cuuu u ucua   a
   gguugcu      gucg   a    ----      uaca       -    g g    ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 11261436-11261546 [+]
intergenic
Database links

Mature sequence ame-miR-3725-3p

Accession MIMAT0018592
Sequence

72 - 

uuucuacauuucuucguaaag

 - 92

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).