Stem-loop sequence ame-mir-3724

AccessionMI0016220 (change log)
DescriptionApis mellifera miR-3724 stem-loop
Stem-loop
   u   g   -       ucc    ---u    --  a gg  a     -aa    ua         -   -   gaa 
5'  ucu aua auuuaaa   guuu    cgau  uc u  au gaacg   ugag  gaauauuug guu aau   u
    ||| ||| |||||||   ||||    ||||  || |  || |||||   ||||  ||||||||| ||| |||   a
3'  aga uau uaaguuu   caaa    gcua  ag g  ua uuugu   acuu  uuugugaac cga uua   c
   -   a   a       ---    uggu    aa  a uu  a     aaa    --         u   a   aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 7466388-7466527 [+]
intergenic
Database links

Mature sequence ame-miR-3724-3p

Accession MIMAT0018590
Sequence

114 - 

aucgugguaaacuuugaauaua

 - 135

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).