Stem-loop sequence ame-mir-3723

AccessionMI0016219 (change log)
DescriptionApis mellifera miR-3723 stem-loop
Stem-loop
   ga    aagucacuau        u  ca -   ----uu    --       -----     gu 
5'   ccgg          uuucggag ua  g cgu      caaa  guuuucg     uaaau  a
     ||||          |||||||| ||  | |||      ||||  |||||||     |||||   
3'   ggcc          aaggccuc au  c gca      guuu  caaaggc     auuug  a
   -a    ----------        u  ag a   cacuuu    cc       uaaaa     ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 4545994-4546102 [+]
intergenic
Database links

Mature sequence ame-miR-3723-5p

Accession MIMAT0018589
Sequence

27 - 

acagcguuucaaaguuuucgua

 - 48

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).