Stem-loop sequence ame-mir-3801

AccessionMI0016218 (change log)
DescriptionApis mellifera miR-3801 stem-loop
Stem-loop
   auu     -c   acag     ag   u  gguac     g  a    g agg        aa   -----ag    a 
5'    ggauc  ggu    uguac  uuu gc     aaauc cg uuga a   cgagccgu  ugc       gcgu u
      |||||  |||    |||||  ||| ||     ||||| || |||| |   ||||||||  |||       ||||  
3'    ucugg  ccg    gcaug  aga cg     uuugg gc gacu u   gcuuggca  acg       ugca g
   ---     uu   ----     ga   u  agcua     g  -    g --a        --   cuaacaa    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000055.5: 11825440-11825579 [+]
intergenic
Database links

Mature sequence ame-miR-3801-5p

Accession MIMAT0018588
Sequence

36 - 

aaucgcgauugagaaggcgagc

 - 57

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).