Stem-loop sequence ame-mir-3800

AccessionMI0016217 (change log)
DescriptionApis mellifera miR-3800 stem-loop
Stem-loop
   --uac     uc    c   ga u      -c    ac  uccuuaa       uaaau 
5'      ugugg  caca guu  c gucucg  ggcc  gu       aaggcgg     c
        |||||  |||| |||  | ||||||  ||||  ||       |||||||     a
3'      auacc  gugu uag  g cggagc  ccgg  ca       uuccgcu     c
   aauac     --    -   uc c      ca    -c  uuuuucc       uugcg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000055.5: 11447203-11447316 [-]
intergenic
Database links

Mature sequence ame-miR-3800-3p

Accession MIMAT0018587
Sequence

88 - 

cgaggccgcugauugugccaua

 - 109

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).