Stem-loop sequence ame-mir-3798

AccessionMI0016214 (change log)
DescriptionApis mellifera miR-3798 stem-loop
Stem-loop
   -c       uu       -c    -cuc   uaau      -a     a 
5'   uuuuaaa  aaauaca  uuau    gaa    uucucc  guauc a
     |||||||  |||||||  ||||    |||    ||||||  ||||| a
3'   agaauuu  uuuaugu  aaua    cuu    aagagg  cauag a
   ua       -c       cu    aaua   ---u      ga     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000055.5: 5535408-5535500 [-]
intergenic
Database links

Mature sequence ame-miR-3798-3p

Accession MIMAT0018584
Sequence

65 - 

ucauaaauaaucuguauuucuuua

 - 88

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).