Stem-loop sequence ame-mir-3477

AccessionMI0016213 (change log)
DescriptionApis mellifera miR-3477 stem-loop
Gene family MIPF0001227; mir-3477
Stem-loop
   -uu       guu  a     u         c     c       gug  a 
5'    ugguagc   gg guggg aaucucaug gguaa ugugagu   ug a
      |||||||   || ||||| ||||||||| ||||| |||||||   || u
3'    accauug   cc caccc uuggggugc ccauu auacucg   au u
   auu       ---  -     u         u     -       aaa  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000055.5: 3363469-3363567 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-3477
ame-mir-283CM000055.5: 3364239-3364338 [-]
ame-mir-3477CM000055.5: 3363469-3363567 [-]
ame-mir-12CM000055.5: 3362974-3363056 [-]
Database links

Mature sequence ame-miR-3477-5p

Accession MIMAT0018583
Sequence

21 - 

uaaucucaugcgguaacugugag

 - 43

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).