Stem-loop sequence ame-mir-3796

AccessionMI0016211 (change log)
DescriptionApis mellifera miR-3796 stem-loop
Stem-loop
   u  -  -   ----g      a          --g     g   ------    a   -uua      a 
5'  cc au cgu     acgaau uucuucucuc   gggau cga      cucg gag    ucgggu a
    || || |||     |||||| ||||||||||   ||||| |||      |||| |||    |||||| u
3'  gg ua gca     uguuua gagaggaggg   uccua gcu      gagu uuc    gguucg u
   u  c  u   guuaa      g          gaa     -   uaguuu    a   uuug      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000069.5: 775446-775570 [+]
intergenic
Database links

Mature sequence ame-miR-3796-3p

Accession MIMAT0018581
Sequence

85 - 

gauccuaaggggaggagaggauuu

 - 108

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).