Stem-loop sequence ame-mir-3795

AccessionMI0016210 (change log)
DescriptionApis mellifera miR-3795 stem-loop
Stem-loop
   aau    u -       ug   g      a    --      c 
5'    ugcg c gacacgu  gac uguuua uuaa  uucauu g
      |||| | |||||||  ||| |||||| ||||  |||||| u
3'    acgc g cugugca  uug gcaggu aauu  aaguga g
   --c    u u       ca   -      -    ua      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000069.5: 1099406-1099487 [-]
intergenic
Database links

Mature sequence ame-miR-3795-5p

Accession MIMAT0018580
Sequence

5 - 

gcgucgacacguuggacguguu

 - 26

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).