Stem-loop sequence ame-mir-3790

AccessionMI0016199 (change log)
DescriptionApis mellifera miR-3790 stem-loop
Stem-loop
   a  aa      -------------------a    --      ga    g     ugag 
5'  ga  gcgauu                    agcg  aucgag  gucu ggcgg    a
    ||  ||||||                    ||||  ||||||  |||| |||||     
3'  cu  cgcuag                    uugc  ugguuc  caga ccguc    a
   c  ag      gagggagagagaaggagaag    au      -g    a     uaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000065.5: 9579873-9579970 [+]
intergenic
Database links

Mature sequence ame-miR-3790-5p

Accession MIMAT0018569
Sequence

2 - 

gaaagcgauuaagcgaucgag

 - 22

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).