Stem-loop sequence ame-mir-3789

AccessionMI0016198 (change log)
DescriptionApis mellifera miR-3789 stem-loop
Stem-loop
   -  g u  a    gg      uu g a   -   a  a  ug  ------     
5'  cc c cg acuc  cccucg  u g ccg gca ca au  gc      cgcc 
    || | || ||||  ||||||  | | ||| ||| || ||  ||      ||| g
3'  gg g gc uggg  gggagu  a u ggc cgu gu ua  cg      gcgc 
   u  g c  a    --      gg g -   u   g  c  gu  uaguac     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000065.5: 9663654-9663751 [-]
intergenic
Database links

Mature sequence ame-miR-3789-3p

Accession MIMAT0018568
Sequence

62 - 

aucuggugcucggugaggugag

 - 83

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).